Transcript: Mouse NM_001252250.1

Mus musculus neurofibromin 2 (Nf2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Nf2 (18016)
Length:
4777
CDS:
560..2335

Additional Resources:

NCBI RefSeq record:
NM_001252250.1
NBCI Gene record:
Nf2 (18016)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001252250.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311587 ACATACCGAGCTTCGACATTA pLKO_005 2040 CDS 100% 13.200 18.480 N Nf2 n/a
2 TRCN0000042519 GCAGCAAGCATAATACCATTA pLKO.1 2274 CDS 100% 10.800 15.120 N Nf2 n/a
3 TRCN0000327288 GCAGCAAGCATAATACCATTA pLKO_005 2274 CDS 100% 10.800 15.120 N Nf2 n/a
4 TRCN0000042518 CGAGCGTACAAGAGATGAGTT pLKO.1 1606 CDS 100% 4.950 6.930 N Nf2 n/a
5 TRCN0000042522 CAAGAGGAATTGCTCCCGAAA pLKO.1 1052 CDS 100% 4.050 5.670 N Nf2 n/a
6 TRCN0000042521 CCTATTTATGAGGCGACGGAA pLKO.1 1474 CDS 100% 2.640 3.696 N Nf2 n/a
7 TRCN0000327245 CCTATTTATGAGGCGACGGAA pLKO_005 1474 CDS 100% 2.640 3.696 N Nf2 n/a
8 TRCN0000042520 GCTCTTAGAAATCGCCACCAA pLKO.1 1972 CDS 100% 2.640 3.696 N Nf2 n/a
9 TRCN0000327319 GCTCTTAGAAATCGCCACCAA pLKO_005 1972 CDS 100% 2.640 3.696 N Nf2 n/a
10 TRCN0000237845 GACAAGGAGTTTACTATTAAA pLKO_005 1361 CDS 100% 15.000 10.500 N NF2 n/a
11 TRCN0000311589 AGTAGAGGGCTGGCTTGTTTG pLKO_005 2473 3UTR 100% 10.800 7.560 N Nf2 n/a
12 TRCN0000039975 GCTTCGTGTTAATAAGCTGAT pLKO.1 1426 CDS 100% 4.050 2.835 N NF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252250.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01087 pDONR223 100% 77.3% 84.2% None (many diffs) n/a
2 ccsbBroad304_01087 pLX_304 0% 77.3% 84.2% V5 (many diffs) n/a
3 TRCN0000468924 AAGGCCGCCAGGCTCCATGAATCA pLX_317 27.6% 77.3% 84.2% V5 (many diffs) n/a
Download CSV