Transcript: Human NM_001252290.1

Homo sapiens TNF superfamily member 8 (TNFSF8), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
TNFSF8 (944)
Length:
1526
CDS:
293..787

Additional Resources:

NCBI RefSeq record:
NM_001252290.1
NBCI Gene record:
TNFSF8 (944)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001252290.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058167 CATTCCCAACTCACCTGACAA pLKO.1 493 CDS 100% 4.950 6.930 N TNFSF8 n/a
2 TRCN0000058166 GACCTCTTATGTATCCTGAAA pLKO.1 545 CDS 100% 4.950 3.465 N TNFSF8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252290.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00256 pDONR223 100% 66.9% 56.4% None (many diffs) n/a
2 ccsbBroad304_00256 pLX_304 0% 66.9% 56.4% V5 (many diffs) n/a
3 TRCN0000477777 GCGAATACTCCCGTGCCGTCTTTA pLX_317 47.8% 66.9% 56.4% V5 (many diffs) n/a
Download CSV