Transcript: Mouse NM_001252548.1

Mus musculus cDNA sequence BC017643 (BC017643), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
BC017643 (217370)
Length:
2463
CDS:
310..873

Additional Resources:

NCBI RefSeq record:
NM_001252548.1
NBCI Gene record:
BC017643 (217370)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001252548.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329539 GTCCCTGCTGGTCGGAATATT pLKO_005 381 CDS 100% 15.000 21.000 N BC017643 n/a
2 TRCN0000329540 TGCCTATTACAGTGGAGATAG pLKO_005 420 CDS 100% 10.800 15.120 N BC017643 n/a
3 TRCN0000329613 ACACTGGGAAGGTCATCTTAA pLKO_005 530 CDS 100% 13.200 9.240 N BC017643 n/a
4 TRCN0000329538 ATGTCACAGGCTGCCTATTTG pLKO_005 461 CDS 100% 13.200 9.240 N BC017643 n/a
5 TRCN0000201149 CACTGGGAAGGTCATCTTAAA pLKO.1 531 CDS 100% 13.200 9.240 N BC017643 n/a
6 TRCN0000200993 CCCAGATGAAACGTGAAGTAT pLKO.1 2162 3UTR 100% 5.625 3.938 N BC017643 n/a
7 TRCN0000329609 CCCAGATGAAACGTGAAGTAT pLKO_005 2162 3UTR 100% 5.625 3.938 N BC017643 n/a
8 TRCN0000190337 CAAGAACACTGGGAAGGTCAT pLKO.1 525 CDS 100% 4.050 2.835 N BC017643 n/a
9 TRCN0000190623 GCAGGTAAATGCCATCCACTT pLKO.1 889 3UTR 100% 4.050 2.835 N BC017643 n/a
10 TRCN0000201783 GCTGCCTATTACAGTGGAGAT pLKO.1 418 CDS 100% 4.050 2.835 N BC017643 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252548.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04074 pDONR223 100% 86.9% 88.7% None (many diffs) n/a
2 ccsbBroad304_04074 pLX_304 0% 86.9% 88.7% V5 (many diffs) n/a
3 TRCN0000469325 AATCTTAATGATTTTACGCACATA pLX_317 62.6% 86.9% 88.7% V5 (many diffs) n/a
Download CSV