Transcript: Mouse NM_001252577.1

Mus musculus killer cell lectin-like receptor, subfamily A, member 4 (Klra4), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Klra4 (16635)
Length:
959
CDS:
146..937

Additional Resources:

NCBI RefSeq record:
NM_001252577.1
NBCI Gene record:
Klra4 (16635)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001252577.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256455 CACACAGGCAGAGGTGTTAAA pLKO_005 548 CDS 100% 13.200 6.600 Y Klra4 n/a
2 TRCN0000256456 GGTTCTGTTATGGTATGAAAT pLKO_005 576 CDS 100% 13.200 6.600 Y Klra4 n/a
3 TRCN0000265819 TGCTGGATTGGATTGTCATAT pLKO_005 731 CDS 100% 13.200 6.600 Y Klra4 n/a
4 TRCN0000065458 GCAGTGCTTATGACAAACATT pLKO.1 329 CDS 100% 5.625 2.813 Y Klra4 n/a
5 TRCN0000067965 TGGTTCTGTTATGGTATGAAA pLKO.1 575 CDS 100% 5.625 2.813 Y Klra18 n/a
6 TRCN0000065461 CCACAATAACTGCAGCATCAT pLKO.1 397 CDS 100% 4.950 2.475 Y Klra4 n/a
7 TRCN0000065459 CCCATCTAAACTTGCCTTGAA pLKO.1 790 CDS 100% 4.950 2.475 Y Klra4 n/a
8 TRCN0000065756 CCTTCAGACAGTTGCTGGATT pLKO.1 719 CDS 100% 4.950 2.475 Y Klra12 n/a
9 TRCN0000067964 CTTGCCTTGAACACAACGAAA pLKO.1 800 CDS 100% 4.950 2.475 Y Klra18 n/a
10 TRCN0000065755 GACATCAACTTGAAGGATGAA pLKO.1 425 CDS 100% 4.950 2.475 Y Klra12 n/a
11 TRCN0000065561 GATTGGACAAATTCCCTCATT pLKO.1 915 CDS 100% 4.950 2.475 Y Klra15 n/a
12 TRCN0000065462 GCAAAGTGACATCAACTTGAA pLKO.1 418 CDS 100% 4.950 2.475 Y Klra4 n/a
13 TRCN0000067966 TCTGTATTTGTGGGAAGAGAT pLKO.1 897 CDS 100% 4.950 2.475 Y Klra18 n/a
14 TRCN0000174124 TCTGTATTTGTGGGAAGAGAT pLKO.1 897 CDS 100% 4.950 2.475 Y Klra18 n/a
15 TRCN0000065754 GCTGTGAGATTCCATAAGTCT pLKO.1 173 CDS 100% 3.000 1.500 Y Klra12 n/a
16 TRCN0000068287 CCATAAGTCTTCAGGGTTGCA pLKO.1 184 CDS 100% 2.640 1.320 Y Klra23 n/a
17 TRCN0000065460 GCTGCCAGAATTCCAGCTTAA pLKO.1 645 CDS 100% 0.000 0.000 Y Klra4 n/a
18 TRCN0000067920 GCCTCAGAGTGTGTTCAGTTT pLKO.1 249 CDS 100% 4.950 2.475 Y Klra16 n/a
19 TRCN0000065560 GCTGCCAGAATTCCAGCTTAT pLKO.1 645 CDS 100% 0.000 0.000 Y Klra15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252577.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.