Transcript: Mouse NM_001252635.1

Mus musculus cadherin 23 (otocadherin) (Cdh23), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Cdh23 (22295)
Length:
11090
CDS:
408..10466

Additional Resources:

NCBI RefSeq record:
NM_001252635.1
NBCI Gene record:
Cdh23 (22295)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001252635.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094659 CGCGTGAAGATCGTCATCAAT pLKO.1 9267 CDS 100% 5.625 7.875 N Cdh23 n/a
2 TRCN0000094661 CGACTACCTTTCTTCACCAAT pLKO.1 486 CDS 100% 4.950 3.465 N Cdh23 n/a
3 TRCN0000094662 CGAGAGAAGAAGGACCACTAT pLKO.1 7794 CDS 100% 4.950 3.465 N Cdh23 n/a
4 TRCN0000094663 CCTTACTACATCAACCTGGTA pLKO.1 2745 CDS 100% 2.640 1.848 N Cdh23 n/a
5 TRCN0000094660 CCTCTGGATTACGAGCAGATA pLKO.1 2277 CDS 100% 4.950 2.970 N Cdh23 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001252635.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08824 pDONR223 100% 27.9% 29.2% None (many diffs) n/a
2 ccsbBroad304_08824 pLX_304 0% 27.9% 29.2% V5 (many diffs) n/a
3 TRCN0000471698 CTCATGCCTGTACGGATTGGTAGG pLX_317 12.9% 27.9% 29.2% V5 (many diffs) n/a
Download CSV