Transcript: Human NM_001253.4

Homo sapiens cell division cycle 5 like (CDC5L), mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
CDC5L (988)
Length:
6241
CDS:
119..2527

Additional Resources:

NCBI RefSeq record:
NM_001253.4
NBCI Gene record:
CDC5L (988)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001253.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075020 CCGAGGAATCTGGCATAACAA pLKO.1 1089 CDS 100% 5.625 7.875 N CDC5L n/a
2 TRCN0000291960 CCGAGGAATCTGGCATAACAA pLKO_005 1089 CDS 100% 5.625 7.875 N CDC5L n/a
3 TRCN0000075022 GCGAGTGAAATTGCACGTCAA pLKO.1 1064 CDS 100% 4.050 5.670 N CDC5L n/a
4 TRCN0000307900 GCGAGTGAAATTGCACGTCAA pLKO_005 1064 CDS 100% 4.050 5.670 N CDC5L n/a
5 TRCN0000075021 GCCAAGACCATCAGAAGTAAA pLKO.1 1753 CDS 100% 13.200 9.240 N CDC5L n/a
6 TRCN0000291961 GCCAAGACCATCAGAAGTAAA pLKO_005 1753 CDS 100% 13.200 9.240 N CDC5L n/a
7 TRCN0000075019 GCGGTAATGAAATATGGGAAA pLKO.1 182 CDS 100% 4.050 2.835 N CDC5L n/a
8 TRCN0000075018 GCTGAAACTGATGTTTATCTT pLKO.1 2586 3UTR 100% 5.625 3.375 N CDC5L n/a
9 TRCN0000291959 GCTGAAACTGATGTTTATCTT pLKO_005 2586 3UTR 100% 5.625 3.375 N CDC5L n/a
10 TRCN0000313559 ATCTCCGTTTAGGGTTGTTAG pLKO_005 1542 CDS 100% 10.800 15.120 N Cdc5l n/a
11 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 5804 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001253.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05969 pDONR223 100% 99.9% 99.8% None 11T>G n/a
2 ccsbBroad304_05969 pLX_304 0% 99.9% 99.8% V5 11T>G n/a
3 TRCN0000479618 CCACATGGACTGATTTATTGTCTA pLX_317 14.3% 99.9% 99.8% V5 11T>G n/a
Download CSV