Transcript: Human NM_001253792.2

Homo sapiens zinc finger protein 444 (ZNF444), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ZNF444 (55311)
Length:
1940
CDS:
268..1248

Additional Resources:

NCBI RefSeq record:
NM_001253792.2
NBCI Gene record:
ZNF444 (55311)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001253792.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017619 GACAGTGGGATGATTCCCTTA pLKO.1 652 CDS 100% 4.050 2.835 N ZNF444 n/a
2 TRCN0000017618 GCGCCTCCCTTGTCTGAACTT pLKO.1 1368 3UTR 100% 1.650 1.155 N ZNF444 n/a
3 TRCN0000315344 GCGCCTCCCTTGTCTGAACTT pLKO_005 1368 3UTR 100% 1.650 1.155 N ZNF444 n/a
4 TRCN0000017622 CCACAGGTGGAAAGGAGGACA pLKO.1 635 CDS 100% 0.880 0.616 N ZNF444 n/a
5 TRCN0000017620 GCAGAGCCACTCGGGCGAGAA pLKO.1 858 CDS 100% 0.000 0.000 N ZNF444 n/a
6 TRCN0000350424 GCAGAGCCACTCGGGCGAGAA pLKO_005 858 CDS 100% 0.000 0.000 N ZNF444 n/a
7 TRCN0000315284 AGGAGGACAGTGGGATGATTC pLKO_005 647 CDS 100% 10.800 6.480 N ZNF444 n/a
8 TRCN0000017621 AGTGTGGCAAGACCTTCTACT pLKO.1 1025 CDS 100% 4.950 2.970 N ZNF444 n/a
9 TRCN0000350425 AGTGTGGCAAGACCTTCTACT pLKO_005 1025 CDS 100% 4.950 2.970 N ZNF444 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001253792.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14197 pDONR223 98.8% 100% 100% None n/a
2 ccsbBroad304_14197 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467702 TCAATTATCACTAGGGGATGGATA pLX_317 21.8% 100% 100% V5 n/a
Download CSV