Transcript: Mouse NM_001253812.1

Mus musculus elongator acetyltransferase complex subunit 3 (Elp3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Elp3 (74195)
Length:
2891
CDS:
113..1813

Additional Resources:

NCBI RefSeq record:
NM_001253812.1
NBCI Gene record:
Elp3 (74195)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001253812.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039310 CGTCGATCTAAATAAGATGAA pLKO.1 274 CDS 100% 4.950 6.930 N Elp3 n/a
2 TRCN0000326973 CGTCGATCTAAATAAGATGAA pLKO_005 274 CDS 100% 4.950 6.930 N Elp3 n/a
3 TRCN0000039312 CCGTGCTAGATATGACCCTTT pLKO.1 583 CDS 100% 4.050 3.240 N Elp3 n/a
4 TRCN0000326972 CCGTGCTAGATATGACCCTTT pLKO_005 583 CDS 100% 4.050 3.240 N Elp3 n/a
5 TRCN0000039309 CGGAGAGATTATGTTGCCAAT pLKO.1 1439 CDS 100% 4.050 3.240 N Elp3 n/a
6 TRCN0000326977 CGGAGAGATTATGTTGCCAAT pLKO_005 1439 CDS 100% 4.050 3.240 N Elp3 n/a
7 TRCN0000039311 GCACAAGAAATTATTACCGAA pLKO.1 1743 CDS 100% 2.640 2.112 N Elp3 n/a
8 TRCN0000326976 GCACAAGAAATTATTACCGAA pLKO_005 1743 CDS 100% 2.640 2.112 N Elp3 n/a
9 TRCN0000039313 CCCTCCTCACTATCGAAAGAT pLKO.1 361 CDS 100% 5.625 3.938 N Elp3 n/a
10 TRCN0000326975 CCCTCCTCACTATCGAAAGAT pLKO_005 361 CDS 100% 5.625 3.938 N Elp3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001253812.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.