Transcript: Mouse NM_001253888.1

Mus musculus testis-specific serine kinase 4 (Tssk4), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Tssk4 (71099)
Length:
1273
CDS:
166..1182

Additional Resources:

NCBI RefSeq record:
NM_001253888.1
NBCI Gene record:
Tssk4 (71099)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001253888.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361793 CTCGAATGGATCCAACGATAT pLKO_005 496 CDS 100% 10.800 15.120 N Tssk4 n/a
2 TRCN0000024240 CCTCGAATGGATCCAACGATA pLKO.1 495 CDS 100% 4.950 6.930 N Tssk4 n/a
3 TRCN0000024241 CTGTGCATAGTAGCCCTTCTT pLKO.1 728 CDS 100% 4.950 3.960 N Tssk4 n/a
4 TRCN0000361794 CCACGTGAGATACAGGTAATG pLKO_005 376 CDS 100% 10.800 7.560 N Tssk4 n/a
5 TRCN0000024243 CTCTGAAGACTATCTCAACAA pLKO.1 348 CDS 100% 4.950 3.465 N Tssk4 n/a
6 TRCN0000024242 GTATGGTTATGAGGTGGGCAA pLKO.1 231 CDS 100% 2.160 1.512 N Tssk4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001253888.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13502 pDONR223 100% 66.6% 64.4% None (many diffs) n/a
2 ccsbBroad304_13502 pLX_304 0% 66.6% 64.4% V5 (many diffs) n/a
3 TRCN0000474270 ACCTGAGATACATACTTGTATTAA pLX_317 29.7% 66.6% 64.4% V5 (many diffs) n/a
Download CSV