Transcript: Human NM_001253891.1

Homo sapiens diacylglycerol O-acyltransferase 2 (DGAT2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
DGAT2 (84649)
Length:
2336
CDS:
260..1297

Additional Resources:

NCBI RefSeq record:
NM_001253891.1
NBCI Gene record:
DGAT2 (84649)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001253891.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005196 CCGGGACACCATAGACTATTT pLKO.1 781 CDS 100% 13.200 18.480 N DGAT2 n/a
2 TRCN0000420935 GCTACTTTCGAGACTACTTTC pLKO_005 531 CDS 100% 10.800 8.640 N DGAT2 n/a
3 TRCN0000005195 GCTGACCACCAGGAACTATAT pLKO.1 580 CDS 100% 13.200 9.240 N DGAT2 n/a
4 TRCN0000424717 GTTCTAGGTGGTGGCTAAATC pLKO_005 1493 3UTR 100% 13.200 9.240 N DGAT2 n/a
5 TRCN0000005194 CCATAGACTATTTGCTTTCAA pLKO.1 789 CDS 100% 5.625 3.938 N DGAT2 n/a
6 TRCN0000005193 GCTCAGCTAACCTCTCTTCTT pLKO.1 1531 3UTR 100% 4.950 3.465 N DGAT2 n/a
7 TRCN0000125475 CCAGGAACTATATCTTTGGAT pLKO.1 588 CDS 100% 3.000 2.100 N Dgat2 n/a
8 TRCN0000349433 CCAGGAACTATATCTTTGGAT pLKO_005 588 CDS 100% 3.000 2.100 N Dgat2 n/a
9 TRCN0000005197 CCTGTACCACACCATGTACAT pLKO.1 1198 CDS 100% 0.495 0.347 N DGAT2 n/a
10 TRCN0000349881 ATGGGTGTCTGTGGGTTATTT pLKO_005 1372 3UTR 100% 15.000 9.000 N Dgat2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001253891.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04407 pDONR223 100% 88.9% 88.9% None 119_120ins129 n/a
2 ccsbBroad304_04407 pLX_304 0% 88.9% 88.9% V5 119_120ins129 n/a
3 TRCN0000468638 GACTATGGAAAGAGTCTCTTCATG pLX_317 39.1% 88.9% 88.9% V5 119_120ins129 n/a
Download CSV