Transcript: Human NM_001253900.1

Homo sapiens mesoderm specific transcript (MEST), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
MEST (4232)
Length:
2471
CDS:
257..1222

Additional Resources:

NCBI RefSeq record:
NM_001253900.1
NBCI Gene record:
MEST (4232)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001253900.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075321 CGCAGGATCAACCTTCTTTCT pLKO.1 629 CDS 100% 4.950 6.930 N MEST n/a
2 TRCN0000333479 CGCAGGATCAACCTTCTTTCT pLKO_005 629 CDS 100% 4.950 6.930 N MEST n/a
3 TRCN0000075318 GCTCTGACTAAGGTTGACATA pLKO.1 1389 3UTR 100% 4.950 6.930 N MEST n/a
4 TRCN0000333542 GCTCTGACTAAGGTTGACATA pLKO_005 1389 3UTR 100% 4.950 6.930 N MEST n/a
5 TRCN0000075322 CTTGAGGTTTCATCGGGTGAT pLKO.1 493 CDS 100% 4.050 5.670 N MEST n/a
6 TRCN0000333539 CTTGAGGTTTCATCGGGTGAT pLKO_005 493 CDS 100% 4.050 5.670 N MEST n/a
7 TRCN0000075319 CGCAACAATGACGGGAACTTA pLKO.1 932 CDS 100% 5.625 4.500 N MEST n/a
8 TRCN0000032678 GAATGCATATATGGGCTTCAT pLKO.1 1189 CDS 100% 4.950 3.960 N Mest n/a
9 TRCN0000075320 CGACTGATGAACTTCTTTGTA pLKO.1 830 CDS 100% 5.625 3.938 N MEST n/a
10 TRCN0000333541 CGACTGATGAACTTCTTTGTA pLKO_005 830 CDS 100% 5.625 3.938 N MEST n/a
11 TRCN0000032675 GCCCTTGATTTCTTAGGCTTT pLKO.1 515 CDS 100% 4.050 2.835 N Mest n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001253900.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01001 pDONR223 100% 95.8% 95.8% None 137_138ins42 n/a
2 ccsbBroad304_01001 pLX_304 0% 95.8% 95.8% V5 137_138ins42 n/a
Download CSV