Transcript: Human NM_001255995.2

Homo sapiens intraflagellar transport 43 (IFT43), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
IFT43 (112752)
Length:
889
CDS:
25..366

Additional Resources:

NCBI RefSeq record:
NM_001255995.2
NBCI Gene record:
IFT43 (112752)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001255995.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000282683 AGGCCGAGAATCACCTCAATG pLKO_005 119 CDS 100% 10.800 7.560 N IFT43 n/a
2 TRCN0000168396 GAATCACCTCAATGGCAAGAA pLKO.1 126 CDS 100% 4.950 3.465 N IFT43 n/a
3 TRCN0000263577 AGAGACTTCCTCTGCTAAATT pLKO_005 168 CDS 100% 15.000 9.000 N IFT43 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001255995.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09377 pDONR223 100% 47.6% 32.3% None (many diffs) n/a
2 ccsbBroad304_09377 pLX_304 0% 47.6% 32.3% V5 (many diffs) n/a
3 TRCN0000472149 CAAACTACACGGGACCCTTGACAT pLX_317 75.4% 47.6% 32.3% V5 (many diffs) n/a
Download CSV