Transcript: Human NM_001256020.2

Homo sapiens triadin (TRDN), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
TRDN (10345)
Length:
1702
CDS:
176..1069

Additional Resources:

NCBI RefSeq record:
NM_001256020.2
NBCI Gene record:
TRDN (10345)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256020.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153017 GCTGTTGCCATCGTTATGTTT pLKO.1 359 CDS 100% 5.625 3.938 N TRDN n/a
2 TRCN0000152213 CAAGAGAAACCTGAAAGGAAA pLKO.1 626 CDS 100% 4.950 3.465 N TRDN n/a
3 TRCN0000151564 GTGTCAAAGCATGAACAGAAA pLKO.1 947 CDS 100% 4.950 3.465 N TRDN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256020.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11486 pDONR223 100% 54.5% 54.3% None (many diffs) n/a
2 ccsbBroad304_11486 pLX_304 0% 54.5% 54.3% V5 (many diffs) n/a
3 TRCN0000481515 ACTGCCGGCGACGTACGGTTCCAG pLX_317 98.4% 54.5% 54.3% V5 (many diffs) n/a
Download CSV