Transcript: Human NM_001256099.2

Homo sapiens collagen triple helix repeat containing 1 (CTHRC1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
CTHRC1 (115908)
Length:
1124
CDS:
46..735

Additional Resources:

NCBI RefSeq record:
NM_001256099.2
NBCI Gene record:
CTHRC1 (115908)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256099.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371999 CATTCTCTCAACCTATAATTT pLKO_005 968 3UTR 100% 15.000 21.000 N CTHRC1 n/a
2 TRCN0000062245 CGCATCATTATTGAAGAACTA pLKO.1 706 CDS 100% 4.950 6.930 N CTHRC1 n/a
3 TRCN0000371997 CTTGGAATGGTTCACTTAAAT pLKO_005 776 3UTR 100% 15.000 10.500 N CTHRC1 n/a
4 TRCN0000371998 TCTTCCCATTGAAGCTATAAT pLKO_005 510 CDS 100% 15.000 10.500 N CTHRC1 n/a
5 TRCN0000062243 GCGTTGGTATTTCACATTCAA pLKO.1 468 CDS 100% 5.625 3.938 N CTHRC1 n/a
6 TRCN0000090645 GCTGAATGTTCAGGACCTCTT pLKO.1 493 CDS 100% 4.050 2.835 N Cthrc1 n/a
7 TRCN0000062247 GTGAAGGAATTGGTGCTGGAT pLKO.1 605 CDS 100% 2.640 1.848 N CTHRC1 n/a
8 TRCN0000062244 CGGGATGGATTCAAAGGAGAA pLKO.1 250 CDS 100% 4.050 2.430 N CTHRC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256099.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04689 pDONR223 100% 87.5% 83.5% None (many diffs) n/a
2 ccsbBroad304_04689 pLX_304 0% 87.5% 83.5% V5 (many diffs) n/a
Download CSV