Transcript: Human NM_001256155.2

Homo sapiens armadillo repeat containing X-linked 4 (ARMCX4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
ARMCX4 (100131755)
Length:
7424
CDS:
203..7075

Additional Resources:

NCBI RefSeq record:
NM_001256155.2
NBCI Gene record:
ARMCX4 (100131755)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256155.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147912 GCCATAAATGAAGCAGAGATT pLKO.1 377 CDS 100% 4.950 3.465 N ARMCX4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256155.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13751 pDONR223 100% 10.4% 10.2% None (many diffs) n/a
2 ccsbBroad304_13751 pLX_304 0% 10.4% 10.2% V5 (many diffs) n/a
3 TRCN0000474670 TATTCCCTCTGCATACCTACTGTC pLX_317 49.8% 10.4% 10.2% V5 (many diffs) n/a
Download CSV