Transcript: Human NM_001256169.2

Homo sapiens apolipoprotein M (APOM), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
APOM (55937)
Length:
722
CDS:
251..601

Additional Resources:

NCBI RefSeq record:
NM_001256169.2
NBCI Gene record:
APOM (55937)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256169.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062511 CGTGCTACCATCCGCATGAAA pLKO.1 287 CDS 100% 5.625 7.875 N APOM n/a
2 TRCN0000062512 CTTGGGCCAGTGGTACTTTAT pLKO.1 163 5UTR 100% 13.200 9.240 N APOM n/a
3 TRCN0000371338 GGACTCCAAAGCCTTCTTATT pLKO_005 538 CDS 100% 13.200 9.240 N APOM n/a
4 TRCN0000062510 TGGACAACATTGTCTTCAATA pLKO.1 231 5UTR 100% 13.200 9.240 N APOM n/a
5 TRCN0000371396 AGCGCTTTCTCCTCTACAATC pLKO_005 459 CDS 100% 10.800 7.560 N APOM n/a
6 TRCN0000062509 CCAGGTGGAATCATGCTGAAT pLKO.1 419 CDS 100% 4.950 3.465 N APOM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256169.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03683 pDONR223 100% 61.7% 61.7% None 0_1ins216 n/a
2 ccsbBroad304_03683 pLX_304 0% 61.7% 61.7% V5 0_1ins216 n/a
3 TRCN0000474828 TCTCCCCATCTAGGCCCAATCAAC pLX_317 55.6% 61.7% 61.7% V5 0_1ins216 n/a
Download CSV