Transcript: Human NM_001256301.1

Homo sapiens 15-hydroxyprostaglandin dehydrogenase (HPGD), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
HPGD (3248)
Length:
2774
CDS:
541..978

Additional Resources:

NCBI RefSeq record:
NM_001256301.1
NBCI Gene record:
HPGD (3248)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256301.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000197 GAAGGCGGCATCATTATCAAT pLKO.1 562 CDS 100% 5.625 4.500 N HPGD n/a
2 TRCN0000000195 GCTGGAGTGAATAATGAGAAA pLKO.1 451 5UTR 100% 4.950 3.960 N HPGD n/a
3 TRCN0000436253 TGCTTTAAATGGTGCTATTAT pLKO_005 885 CDS 100% 15.000 10.500 N HPGD n/a
4 TRCN0000422524 AGCGTTGGCTGCTAATCTTAT pLKO_005 672 CDS 100% 13.200 9.240 N HPGD n/a
5 TRCN0000427212 GACCAAAGGCTAGGTTGTAAT pLKO_005 1173 3UTR 100% 13.200 9.240 N HPGD n/a
6 TRCN0000418011 GACTATGATACAACTCCATTT pLKO_005 940 CDS 100% 10.800 7.560 N HPGD n/a
7 TRCN0000000198 CACAGCCATCCTTGAATCAAT pLKO.1 738 CDS 100% 5.625 3.938 N HPGD n/a
8 TRCN0000000194 ACTCATAACAACACAGACATA pLKO.1 1953 3UTR 100% 4.950 3.465 N HPGD n/a
9 TRCN0000000196 GCAACAACTGAGAGACACTTT pLKO.1 381 5UTR 100% 4.950 3.465 N HPGD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256301.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00782 pDONR223 100% 54.5% 54.5% None 0_1ins363 n/a
2 ccsbBroad304_00782 pLX_304 0% 54.5% 54.5% V5 0_1ins363 n/a
3 TRCN0000468979 TTAATATCGTTATTTACTAACGCA pLX_317 52.6% 54.5% 54.5% V5 0_1ins363 n/a
Download CSV