Transcript: Human NM_001256317.2

Homo sapiens transmembrane serine protease 3 (TMPRSS3), transcript variant F, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
TMPRSS3 (64699)
Length:
2449
CDS:
163..1524

Additional Resources:

NCBI RefSeq record:
NM_001256317.2
NBCI Gene record:
TMPRSS3 (64699)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256317.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415442 GGGATCATTGCATTGATATTA pLKO_005 325 CDS 100% 15.000 21.000 N TMPRSS3 n/a
2 TRCN0000051384 GCCACTCACGTTCAATGAAAT pLKO.1 1098 CDS 100% 13.200 18.480 N TMPRSS3 n/a
3 TRCN0000436505 CGCTCATCCTTTAAGTGTATC pLKO_005 400 CDS 100% 10.800 15.120 N TMPRSS3 n/a
4 TRCN0000434953 TAGTTTCCCTGTTGGACAATC pLKO_005 983 CDS 100% 10.800 15.120 N TMPRSS3 n/a
5 TRCN0000051383 CGTCCCTTTGATTTCCAACAA pLKO.1 1242 CDS 100% 4.950 6.930 N TMPRSS3 n/a
6 TRCN0000051386 CCTTCTCATTCCGATCGCTTT pLKO.1 197 CDS 100% 4.050 5.670 N TMPRSS3 n/a
7 TRCN0000051385 GCATTACACCACTCAGTATAT pLKO.1 709 CDS 100% 13.200 9.240 N TMPRSS3 n/a
8 TRCN0000051387 CAACTGGGTTTCCCAAGCTAT pLKO.1 592 CDS 100% 4.950 3.465 N TMPRSS3 n/a
9 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 1893 3UTR 100% 4.950 2.475 Y n/a
10 TRCN0000032264 CCCAACTCTGAAGAGAACTTT pLKO.1 1138 CDS 100% 5.625 3.938 N Tmprss3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256317.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12477 pDONR223 100% 99.9% 100% None 453G>A n/a
2 ccsbBroad304_12477 pLX_304 0% 99.9% 100% V5 453G>A n/a
3 TRCN0000478110 AAAACCCTTACACCGGTATCAACT pLX_317 28% 99.9% 100% V5 453G>A n/a
Download CSV