Transcript: Human NM_001256404.2

Homo sapiens DENN domain containing 2C (DENND2C), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
DENND2C (163259)
Length:
6177
CDS:
641..3427

Additional Resources:

NCBI RefSeq record:
NM_001256404.2
NBCI Gene record:
DENND2C (163259)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256404.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167282 CGTAGGACATTCAGATATTTA pLKO.1 1280 CDS 100% 15.000 12.000 N DENND2C n/a
2 TRCN0000167015 GCCTTGTTGTTGTTACATTTA pLKO.1 3744 3UTR 100% 13.200 10.560 N DENND2C n/a
3 TRCN0000425935 GATATTCAGCACTTTCGAAAT pLKO_005 1466 CDS 100% 10.800 8.640 N DENND2C n/a
4 TRCN0000167196 CCATCAGGAATAAGCTATATT pLKO.1 2147 CDS 100% 15.000 10.500 N DENND2C n/a
5 TRCN0000424097 CCGATTGGAACATGTTGATTT pLKO_005 2626 CDS 100% 13.200 9.240 N DENND2C n/a
6 TRCN0000418464 TGGATAGTTCATACGGAATAA pLKO_005 1182 CDS 100% 13.200 9.240 N DENND2C n/a
7 TRCN0000167303 CCAATCCTTAAATCAACCTTA pLKO.1 4391 3UTR 100% 4.950 3.465 N DENND2C n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5460 3UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5460 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256404.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13334 pDONR223 100% 87.8% 87.8% None 6T>A;1341C>T;1924_2259del n/a
2 ccsbBroad304_13334 pLX_304 0% 87.8% 87.8% V5 6T>A;1341C>T;1924_2259del n/a
3 TRCN0000472271 GCTTAGCCCCTCTCTGAAATGCAC pLX_317 15.9% 87.8% 87.8% V5 6T>A;1341C>T;1924_2259del n/a
Download CSV