Transcript: Human NM_001256420.2

Homo sapiens microtubule associated protein RP/EB family member 2 (MAPRE2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
MAPRE2 (10982)
Length:
4084
CDS:
159..983

Additional Resources:

NCBI RefSeq record:
NM_001256420.2
NBCI Gene record:
MAPRE2 (10982)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256420.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116508 GCAAGCATCATTTAAGCGAAT pLKO.1 362 CDS 100% 4.050 5.670 N MAPRE2 n/a
2 TRCN0000116509 CCAGGATAATAACGGGACCAT pLKO.1 184 CDS 100% 2.640 3.696 N MAPRE2 n/a
3 TRCN0000430272 ACTACGATGGGAAGGAGTATG pLKO_005 481 CDS 100% 10.800 7.560 N MAPRE2 n/a
4 TRCN0000116511 AGCTTAATGAACAGGTACATT pLKO.1 736 CDS 100% 5.625 3.938 N MAPRE2 n/a
5 TRCN0000116510 GCATCCAAATCCGATAAAGAT pLKO.1 696 CDS 100% 5.625 3.938 N MAPRE2 n/a
6 TRCN0000116507 GCTGCTCTTGACACTTCCATT pLKO.1 993 3UTR 100% 4.950 3.465 N MAPRE2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256420.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02587 pDONR223 100% 83.7% 75.3% None 0_1ins31;88_89ins128 n/a
2 ccsbBroad304_02587 pLX_304 0% 83.7% 75.3% V5 0_1ins31;88_89ins128 n/a
3 TRCN0000467311 AAACTTTGATACGATTGTACTTTT pLX_317 32.8% 83.7% 75.3% V5 0_1ins31;88_89ins128 n/a
Download CSV