Construct: ORF TRCN0000467311
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000398.1_s317c1
- Derived from:
- ccsbBroadEn_02587
- DNA Barcode:
- AAACTTTGATACGATTGTACTTTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MAPRE2 (10982)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467311
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10982 | MAPRE2 | microtubule associated prot... | NM_014268.4 | 100% | 100% | |
| 2 | human | 10982 | MAPRE2 | microtubule associated prot... | NM_001143827.3 | 91.3% | 89.6% | (many diffs) |
| 3 | human | 10982 | MAPRE2 | microtubule associated prot... | NM_001143826.2 | 86.8% | 86.8% | 0_1ins129 |
| 4 | human | 10982 | MAPRE2 | microtubule associated prot... | NM_001256420.2 | 83.7% | 75.3% | 0_1ins31;88_89ins128 |
| 5 | human | 10982 | MAPRE2 | microtubule associated prot... | NR_046177.2 | 22.7% | 1_127del;247_351del;1214_4317del | |
| 6 | mouse | 212307 | Mapre2 | microtubule-associated prot... | NM_153058.4 | 90.8% | 96.9% | (many diffs) |
| 7 | mouse | 212307 | Mapre2 | microtubule-associated prot... | NM_001162941.1 | 83.2% | 84.4% | (many diffs) |
| 8 | mouse | 212307 | Mapre2 | microtubule-associated prot... | NM_001162942.1 | 78.4% | 84% | (many diffs) |
| 9 | mouse | 212307 | Mapre2 | microtubule-associated prot... | XM_006525744.1 | 78.4% | 84% | (many diffs) |
| 10 | mouse | 212307 | Mapre2 | microtubule-associated prot... | XM_006525745.2 | 75.6% | 72.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1047
- ORF length:
- 981
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc tgggccgacc caaaccctgt ccccaaatgg cgagaacaac aacgacatca 121 tccaggataa taacgggacc atcattcctt tccggaagca cacagtgcgc ggggagcgtt 181 cctacagttg gggaatggcg gtcaatgtgt attctacctc gataacccaa gagactatga 241 gcagacatga catcattgca tgggttaatg acatagtatc tttaaactac acaaaagtgg 301 aacagctttg ttcaggagcg gcctattgcc aattcatgga catgctcttc cctggctgca 361 ttagtttgaa gaaagtaaaa tttcaagcaa agctggaaca tgaatatatt cacaatttta 421 aacttctgca agcatcattt aagcgaatga acgttgataa ggtaattcca gtggagaagc 481 tagtgaaagg acgtttccag gacaacctgg attttattca atggtttaag aaattctatg 541 atgctaacta cgatgggaag gagtatgatc ctgtagaggc acgacaaggg caagatgcaa 601 ttcctcctcc tgaccctggt gaacagatct tcaacctgcc aaaaaagtct caccatgcaa 661 actcccccac agcaggtgca gctaaatcaa gtccagcagc taaaccagga tccacacctt 721 ctcgacccTC ATCAGCCAAA AGGGCTTCTT CCAGTGGCTC AGCATCCAAA TCCGATAAAG 781 ATTTAGAAAC GCAGGTCATA CAGCTTAATG AACAGGTACA TTCATTAAAA CTTGCCCTTG 841 AAGGCGTGGA AAAGGAAAGG GATTTCTACT TTGGGAAGTT GAGAGAGATC GAGCTACTCT 901 GCCAAGAACA CGGGCAGGAA AATGATGACC TCGTGCAGAG ACTAATGGAC ATCCTGTATG 961 CTTCAGAAGA ACACGAGGGC CACACAGAAG AGCCGGAAGC AGAGGAGCAA GCCCACGAAC 1021 AGCAGCCCCC GCAGCAGGAA GAGTACTGCC CAACTTTCTT GTACAAAGTG GTTGATATCG 1081 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGCCCGT 1141 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GAAAACTTTG 1201 ATACGATTGT ACTTTTACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1261 aagatt