Transcript: Mouse NM_001256516.1

Mus musculus zinc finger protein 672 (Zfp672), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Zfp672 (319475)
Length:
2950
CDS:
566..1972

Additional Resources:

NCBI RefSeq record:
NM_001256516.1
NBCI Gene record:
Zfp672 (319475)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001256516.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310968 GCAACCATGCAGGCCATAAAC pLKO_005 1650 CDS 100% 13.200 9.240 N Zfp672 n/a
2 TRCN0000085266 AGGCCCATCTATGTGGCATAT pLKO.1 1164 CDS 100% 10.800 7.560 N Zfp672 n/a
3 TRCN0000316050 AGGCCCATCTATGTGGCATAT pLKO_005 1164 CDS 100% 10.800 7.560 N Zfp672 n/a
4 TRCN0000304425 ATAGTTGAAGAGGTAACATAC pLKO_005 2300 3UTR 100% 10.800 7.560 N Zfp672 n/a
5 TRCN0000085263 CCTGTTAATCTCTACTGCTTT pLKO.1 2265 3UTR 100% 4.950 3.465 N Zfp672 n/a
6 TRCN0000085264 GCGATTCACCTGCATTTCCAA pLKO.1 1612 CDS 100% 3.000 2.100 N Zfp672 n/a
7 TRCN0000316028 GCGATTCACCTGCATTTCCAA pLKO_005 1612 CDS 100% 3.000 2.100 N Zfp672 n/a
8 TRCN0000085265 CCCAGGAAAGACCTTATTCCT pLKO.1 594 CDS 100% 0.300 0.210 N Zfp672 n/a
9 TRCN0000316029 CCCAGGAAAGACCTTATTCCT pLKO_005 594 CDS 100% 0.300 0.210 N Zfp672 n/a
10 TRCN0000085267 CTGTAGTCACTGAGGTGACAA pLKO.1 1869 CDS 100% 0.495 0.297 N Zfp672 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256516.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.