Transcript: Human NM_001256541.2

Homo sapiens transmembrane protein 204 (TMEM204), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
TMEM204 (79652)
Length:
1684
CDS:
462..1142

Additional Resources:

NCBI RefSeq record:
NM_001256541.2
NBCI Gene record:
TMEM204 (79652)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256541.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148906 CCCAGCCATATCTTACACTTT pLKO.1 1506 3UTR 100% 4.950 6.930 N TMEM204 n/a
2 TRCN0000150207 GTTTACTGTTATGTCGGTCAT pLKO.1 1296 3UTR 100% 4.050 5.670 N TMEM204 n/a
3 TRCN0000441019 ACTACGTGGAGTCACCATGCT pLKO_005 1120 CDS 100% 2.640 3.696 N TMEM204 n/a
4 TRCN0000427260 CAAACTGCAGTTCGACATGAT pLKO_005 737 CDS 100% 4.950 3.960 N TMEM204 n/a
5 TRCN0000415848 CCATGCTCATCTGGAACATTC pLKO_005 1012 CDS 100% 10.800 7.560 N TMEM204 n/a
6 TRCN0000438570 CATCAACGCACACCTGCTATC pLKO_005 1162 3UTR 100% 6.000 4.200 N TMEM204 n/a
7 TRCN0000149554 GCTCGTGACTTTCTACAGAAT pLKO.1 917 CDS 100% 4.950 3.465 N TMEM204 n/a
8 TRCN0000417438 TGCATTCCAACTGGCGAGTTT pLKO_005 881 CDS 100% 4.950 3.465 N TMEM204 n/a
9 TRCN0000148062 GCCATATCTTACACTTTGGTA pLKO.1 1510 3UTR 100% 3.000 2.100 N TMEM204 n/a
10 TRCN0000181169 CTCACTCATCCTCAACAACGT pLKO.1 509 CDS 100% 2.640 1.848 N TMEM204 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256541.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04100 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04100 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472821 GGTTCTGGGCTGCTTCATCACAGA pLX_317 70.4% 100% 100% V5 n/a
Download CSV