Transcript: Human NM_001256620.1

Homo sapiens R3H domain and coiled-coil containing 1 like (R3HCC1L), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-02-23
Taxon:
Homo sapiens (human)
Gene:
R3HCC1L (27291)
Length:
3390
CDS:
300..2636

Additional Resources:

NCBI RefSeq record:
NM_001256620.1
NBCI Gene record:
R3HCC1L (27291)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256620.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255879 CGGAGGCTCGAAGACTAAATA pLKO_005 496 CDS 100% 15.000 21.000 N R3HCC1L n/a
2 TRCN0000135199 CGTGATGCGTTGGGTATTAAA pLKO.1 2334 CDS 100% 15.000 21.000 N R3HCC1L n/a
3 TRCN0000255881 TGATCAAACTTGCGTAGATTT pLKO_005 1130 CDS 100% 13.200 18.480 N R3HCC1L n/a
4 TRCN0000255883 AGCTGATGAGACCTCTATTAA pLKO_005 1502 CDS 100% 15.000 12.000 N R3HCC1L n/a
5 TRCN0000255880 TACAGGAGATGTGGGTATTTA pLKO_005 3177 3UTR 100% 15.000 10.500 N R3HCC1L n/a
6 TRCN0000255882 TGCTTCCTCCTTACCTATAAA pLKO_005 1706 CDS 100% 15.000 10.500 N R3HCC1L n/a
7 TRCN0000135181 CCTAACTCTGTGGTGAAAGAA pLKO.1 426 CDS 100% 5.625 3.938 N R3HCC1L n/a
8 TRCN0000135878 GAATGGACACATGCCTTCAAA pLKO.1 577 CDS 100% 5.625 3.938 N R3HCC1L n/a
9 TRCN0000136511 CCAGATGGTGTCTTTGATCAA pLKO.1 1116 CDS 100% 4.950 3.465 N R3HCC1L n/a
10 TRCN0000137949 GCAAGATGACTCAGGGAGTAT pLKO.1 1895 CDS 100% 4.950 3.465 N R3HCC1L n/a
11 TRCN0000138571 CATGGTGAAGATTCGTCCCTT pLKO.1 2360 CDS 100% 2.640 1.848 N R3HCC1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256620.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11861 pDONR223 100% 23.5% 23.5% None 1_1783del;1784_1785insT n/a
2 ccsbBroad304_11861 pLX_304 0% 23.5% 23.5% V5 1_1783del;1784_1785insT n/a
3 TRCN0000465466 TGGTAGACTAATACCTAGCTCCGG pLX_317 62.2% 23.5% 23.5% V5 1_1783del;1784_1785insT n/a
Download CSV