Transcript: Human NM_001256858.1

Homo sapiens ring finger protein 34 (RNF34), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
RNF34 (80196)
Length:
1479
CDS:
131..673

Additional Resources:

NCBI RefSeq record:
NM_001256858.1
NBCI Gene record:
RNF34 (80196)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001256858.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033951 CGGCACAGGTACAAAGTGAAA pLKO.1 180 CDS 100% 4.950 6.930 N RNF34 n/a
2 TRCN0000298800 CGGCACAGGTACAAAGTGAAA pLKO_005 180 CDS 100% 4.950 6.930 N RNF34 n/a
3 TRCN0000233439 GGCACAGGTACAAAGTGAAAT pLKO_005 181 CDS 100% 13.200 9.240 N Rnf34 n/a
4 TRCN0000033950 GCCTTGATGATGTGGAAGGAA pLKO.1 333 CDS 100% 3.000 1.800 N RNF34 n/a
5 TRCN0000298797 GCCTTGATGATGTGGAAGGAA pLKO_005 333 CDS 100% 3.000 1.800 N RNF34 n/a
6 TRCN0000037290 GCACAGGTACAAAGTGAAATA pLKO.1 182 CDS 100% 13.200 9.240 N Rnf34 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001256858.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04187 pDONR223 100% 48.2% 47.8% None 0_1ins567;4_4delAinsTCTTCGTTTC n/a
2 ccsbBroad304_04187 pLX_304 0% 48.2% 47.8% V5 0_1ins567;4_4delAinsTCTTCGTTTC n/a
3 TRCN0000481577 ATTTTATTCAAGTGATTGCGGGAT pLX_317 48.8% 48.2% 47.8% V5 0_1ins567;4_4delAinsTCTTCGTTTC n/a
Download CSV