Transcript: Human NM_001258032.1

Homo sapiens serine incorporator 4 (SERINC4), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-06-25
Taxon:
Homo sapiens (human)
Gene:
SERINC4 (619189)
Length:
2323
CDS:
673..1497

Additional Resources:

NCBI RefSeq record:
NM_001258032.1
NBCI Gene record:
SERINC4 (619189)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001258032.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220073 TACTGCAGTTGGTGCTTATTA pLKO.1 733 CDS 100% 15.000 10.500 N SERINC4 n/a
2 TRCN0000220074 CCTGTGGATTGTCAAGGTTTA pLKO.1 1044 CDS 100% 10.800 7.560 N SERINC4 n/a
3 TRCN0000179739 CCAGCATCTTTCCTACAACTA pLKO.1 1194 CDS 100% 4.950 3.465 N SERINC4 n/a
4 TRCN0000180469 GCTGAGTGCTAGCATCATGTA pLKO.1 966 CDS 100% 4.950 3.465 N SERINC4 n/a
5 TRCN0000180439 GCCTCACTCTATGTCATGGTT pLKO.1 1243 CDS 100% 3.000 2.100 N SERINC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001258032.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10185 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_10185 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476501 GTAGCGGCTTAACGCTTCAAGGTT pLX_317 47.2% 100% 100% V5 n/a
Download CSV