Transcript: Human NM_001258372.1

Homo sapiens spermatogenesis associated 20 (SPATA20), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-02-23
Taxon:
Homo sapiens (human)
Gene:
SPATA20 (64847)
Length:
2704
CDS:
121..2481

Additional Resources:

NCBI RefSeq record:
NM_001258372.1
NBCI Gene record:
SPATA20 (64847)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001258372.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118377 GTGAAGCATCCCAACTGACTA pLKO.1 2513 3UTR 100% 4.950 6.930 N SPATA20 n/a
2 TRCN0000300602 GTGAAGCATCCCAACTGACTA pLKO_005 2513 3UTR 100% 4.950 6.930 N SPATA20 n/a
3 TRCN0000118380 CCACTCTGTCTACATTCCTAA pLKO.1 2286 CDS 100% 4.950 3.465 N SPATA20 n/a
4 TRCN0000300532 CCACTCTGTCTACATTCCTAA pLKO_005 2286 CDS 100% 4.950 3.465 N SPATA20 n/a
5 TRCN0000118381 CCGCACAGTGTTGCTGAGAAT pLKO.1 702 CDS 100% 4.950 3.465 N SPATA20 n/a
6 TRCN0000310643 CCGCACAGTGTTGCTGAGAAT pLKO_005 702 CDS 100% 4.950 3.465 N SPATA20 n/a
7 TRCN0000118379 CCTCCTACAACATGCCTACAA pLKO.1 336 CDS 100% 4.950 3.465 N SPATA20 n/a
8 TRCN0000118378 CGTCCCTCACTTTGAGAAGAT pLKO.1 1101 CDS 100% 4.950 3.465 N SPATA20 n/a
9 TRCN0000300531 CGTCCCTCACTTTGAGAAGAT pLKO_005 1101 CDS 100% 4.950 3.465 N SPATA20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001258372.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12499 pDONR223 100% 94.2% 94% None (many diffs) n/a
2 ccsbBroad304_12499 pLX_304 0% 94.2% 94% V5 (many diffs) n/a
Download CSV