Transcript: Human NM_001258384.2

Homo sapiens isocitrate dehydrogenase (NAD(+)) 3 non-catalytic subunit beta (IDH3B), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
IDH3B (3420)
Length:
1404
CDS:
36..1166

Additional Resources:

NCBI RefSeq record:
NM_001258384.2
NBCI Gene record:
IDH3B (3420)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001258384.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220340 CGGCATCTTAATCTTGAGTAT pLKO.1 1035 CDS 100% 4.950 6.930 N IDH3B n/a
2 TRCN0000220341 CGGATTGCAAAGTTCGCCTTT pLKO.1 621 CDS 100% 4.050 5.670 N IDH3B n/a
3 TRCN0000220342 CCTTACCAGTTTGATGTGCTT pLKO.1 816 CDS 100% 2.640 3.696 N IDH3B n/a
4 TRCN0000229393 CGGTGAAGAAGGTGATCAAAG pLKO_005 1078 CDS 100% 10.800 7.560 N IDH3B n/a
5 TRCN0000229392 TGCAGAATCCTTACCAGTTTG pLKO_005 808 CDS 100% 10.800 7.560 N IDH3B n/a
6 TRCN0000220344 GCGGTGAAGAAGGTGATCAAA pLKO.1 1077 CDS 100% 5.625 3.938 N IDH3B n/a
7 TRCN0000218789 CCAATCTCTATGGGAACATTA pLKO_005 844 CDS 100% 13.200 7.920 N IDH3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001258384.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00819 pDONR223 100% 94.2% 92.9% None (many diffs) n/a
2 ccsbBroad304_00819 pLX_304 0% 94.2% 92.9% V5 (many diffs) n/a
3 TRCN0000469293 GCAGACGGAGCGGCCAGCTGGTGA pLX_317 40.6% 94.2% 92.9% V5 (many diffs) n/a
Download CSV