Transcript: Human NM_001260495.1

Homo sapiens radixin (RDX), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
RDX (5962)
Length:
1814
CDS:
405..1178

Additional Resources:

NCBI RefSeq record:
NM_001260495.1
NBCI Gene record:
RDX (5962)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001260495.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062435 GCCAGAGATGAAACCAAGAAA pLKO.1 975 CDS 100% 5.625 3.938 N RDX n/a
2 TRCN0000062436 GCAGACAATTAAAGCTCAGAA pLKO.1 431 CDS 100% 4.950 3.465 N RDX n/a
3 TRCN0000414986 GAAGCAACTTCAGGCATTAAG pLKO_005 938 CDS 100% 13.200 7.920 N RDX n/a
4 TRCN0000072062 GTTCAGAATTAGCCCAAGCTA pLKO.1 958 CDS 100% 3.000 2.100 N Rdx n/a
5 TRCN0000352042 GTTCAGAATTAGCCCAAGCTA pLKO_005 958 CDS 100% 3.000 2.100 N Rdx n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001260495.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06855 pDONR223 100% 39% 39% None 0_1ins1041;709_771del n/a
2 ccsbBroad304_06855 pLX_304 0% 39% 39% V5 0_1ins1041;709_771del n/a
3 TRCN0000478656 TTCCGTTTGGCCTCCTGAACCAAT pLX_317 19.3% 39% 39% V5 0_1ins1041;709_771del n/a
Download CSV