Transcript: Human NM_001260502.1

Homo sapiens signal recognition particle 68 (SRP68), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
SRP68 (6730)
Length:
2736
CDS:
36..1805

Additional Resources:

NCBI RefSeq record:
NM_001260502.1
NBCI Gene record:
SRP68 (6730)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001260502.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365300 ATCCGCTATTGTGCATATAAT pLKO_005 651 CDS 100% 15.000 21.000 N SRP68 n/a
2 TRCN0000370477 AGATTGACAAAGTGCGCATTT pLKO_005 838 CDS 100% 10.800 15.120 N SRP68 n/a
3 TRCN0000075078 CCCAGCAAGTTCCATGATATT pLKO.1 1865 3UTR 100% 13.200 10.560 N SRP68 n/a
4 TRCN0000075079 CGACTCTATGACATCATCTTA pLKO.1 1197 CDS 100% 5.625 4.500 N SRP68 n/a
5 TRCN0000365302 AGAAGTTTATCTATGACTATG pLKO_005 2222 3UTR 100% 10.800 7.560 N SRP68 n/a
6 TRCN0000365301 GATACATCAAGGGCATCTTTG pLKO_005 1771 CDS 100% 10.800 7.560 N SRP68 n/a
7 TRCN0000075081 CCAGGGAAGGTGTCTAATCTT pLKO.1 1029 CDS 100% 5.625 3.938 N SRP68 n/a
8 TRCN0000075080 CCGACTCTATGACATCATCTT pLKO.1 1196 CDS 100% 4.950 3.465 N SRP68 n/a
9 TRCN0000075082 CCTCTCAGGAATGCTACGTTT pLKO.1 497 CDS 100% 4.950 3.465 N SRP68 n/a
10 TRCN0000370413 TGGAGATTCTTCAGATTATTA pLKO_005 214 CDS 100% 15.000 9.000 N SRP68 n/a
11 TRCN0000370478 TGATTGCCTTTGGTCAGTAAT pLKO_005 2086 3UTR 100% 13.200 7.920 N SRP68 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001260502.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11157 pDONR223 100% 88.9% 88.9% None 249_250ins114;651_743del n/a
2 ccsbBroad304_11157 pLX_304 0% 88.9% 88.9% V5 249_250ins114;651_743del n/a
3 TRCN0000481598 CGGAAATTTTAATACATTGATGGG pLX_317 26.3% 88.9% 88.9% V5 249_250ins114;651_743del n/a
Download CSV