Transcript: Human NM_001260505.2

Homo sapiens serine/threonine kinase 31 (STK31), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
STK31 (56164)
Length:
3205
CDS:
68..3058

Additional Resources:

NCBI RefSeq record:
NM_001260505.2
NBCI Gene record:
STK31 (56164)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001260505.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000368917 CAAGATTTATGGTGGATTATT pLKO_005 313 CDS 100% 15.000 21.000 N STK31 n/a
2 TRCN0000364397 TACACTCTGAAGACCTATATA pLKO_005 1127 CDS 100% 15.000 12.000 N STK31 n/a
3 TRCN0000003277 GCTATCCATTAAGAAGACATT pLKO.1 1954 CDS 100% 4.950 3.960 N STK31 n/a
4 TRCN0000364395 ATAACTCAGCTGCGCAATAAT pLKO_005 2078 CDS 100% 15.000 10.500 N STK31 n/a
5 TRCN0000364396 ATACTGAATACACCCTATATA pLKO_005 2955 CDS 100% 15.000 10.500 N STK31 n/a
6 TRCN0000194908 CAAGCCAACATGCCTTTAAAT pLKO.1 2528 CDS 100% 15.000 10.500 N STK31 n/a
7 TRCN0000196648 GCAGGCAATCTTATAACATTT pLKO.1 884 CDS 100% 13.200 9.240 N STK31 n/a
8 TRCN0000368919 TGGTACGTTCTGAGGTTAATG pLKO_005 2301 CDS 100% 13.200 9.240 N STK31 n/a
9 TRCN0000368918 TTTGGGCCCAGAGTATCAATA pLKO_005 207 CDS 100% 13.200 9.240 N STK31 n/a
10 TRCN0000196555 GACTTTAATTTAGGGTCTAAC pLKO.1 929 CDS 100% 10.800 7.560 N STK31 n/a
11 TRCN0000003276 CCTCTGTAGCTTGATATGTTA pLKO.1 2848 CDS 100% 5.625 3.938 N STK31 n/a
12 TRCN0000003278 CGGAGAACTTGGATAAATGTA pLKO.1 2997 CDS 100% 5.625 3.938 N STK31 n/a
13 TRCN0000195545 CCACAGTACAAGCTAAGTACA pLKO.1 1866 CDS 100% 4.950 3.465 N STK31 n/a
14 TRCN0000003275 GCAGGATTTGTCAGTCTCTTT pLKO.1 1480 CDS 100% 4.950 3.465 N STK31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001260505.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488677 CTAGCTAACCTGACGCCCCCGGGA pLX_317 11.5% 97.7% 97.6% V5 (not translated due to prior stop codon) 213G>C;2759_2760ins69 n/a
Download CSV