Transcript: Human NM_001260508.1

Homo sapiens potassium inwardly rectifying channel subfamily J member 3 (KCNJ3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
KCNJ3 (3760)
Length:
4523
CDS:
196..903

Additional Resources:

NCBI RefSeq record:
NM_001260508.1
NBCI Gene record:
KCNJ3 (3760)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001260508.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434702 GAATAGCTTTCAGGGCGATAA pLKO_005 1867 3UTR 100% 10.800 15.120 N KCNJ3 n/a
2 TRCN0000044330 CCAATGTCTATAACTTCCCTT pLKO.1 569 CDS 100% 2.640 3.696 N KCNJ3 n/a
3 TRCN0000426057 TACGGAGGGAGGACATCATAA pLKO_005 1655 3UTR 100% 13.200 10.560 N KCNJ3 n/a
4 TRCN0000069737 CCCTTTAATAGCACCAGCCAT pLKO.1 1085 3UTR 100% 2.640 2.112 N Kcnj3 n/a
5 TRCN0000044328 CCCATGAAACTTCAACGAATA pLKO.1 1278 3UTR 100% 10.800 7.560 N KCNJ3 n/a
6 TRCN0000044332 GCTTAGATGGACTAGATGATA pLKO.1 1141 3UTR 100% 5.625 3.938 N KCNJ3 n/a
7 TRCN0000044329 CCAGCCATAACTAACAGCAAA pLKO.1 1098 3UTR 100% 4.950 3.465 N KCNJ3 n/a
8 TRCN0000069734 GCAGGAGGAAATGCTTCTCAT pLKO.1 1058 3UTR 100% 4.950 3.465 N Kcnj3 n/a
9 TRCN0000166498 CGCCTGTAATCCCAGTACTTT pLKO.1 3789 3UTR 100% 5.625 2.813 Y MGC13053 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001260508.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06476 pDONR223 100% 46.8% 46.7% None 702_703insTCTC;705_705delAins795 n/a
2 ccsbBroad304_06476 pLX_304 0% 46.8% 46.7% V5 702_703insTCTC;705_705delAins795 n/a
3 TRCN0000468883 TTGTGATAATGCCGACTGATAATT pLX_317 29.6% 46.8% 46.7% V5 702_703insTCTC;705_705delAins795 n/a
Download CSV