Construct: ORF TRCN0000468883
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014500.1_s317c1
- Derived from:
- ccsbBroadEn_06476
- DNA Barcode:
- TTGTGATAATGCCGACTGATAATT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KCNJ3 (3760)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468883
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3760 | KCNJ3 | potassium inwardly rectifyi... | NM_002239.4 | 99.8% | 99.6% | 811T>C;871G>A;1038T>C |
| 2 | human | 3760 | KCNJ3 | potassium inwardly rectifyi... | NM_001260509.2 | 61.2% | 60.8% | (many diffs) |
| 3 | human | 3760 | KCNJ3 | potassium inwardly rectifyi... | NM_001260510.2 | 49.4% | 47.2% | (many diffs) |
| 4 | human | 3760 | KCNJ3 | potassium inwardly rectifyi... | NM_001260508.1 | 46.8% | 46.7% | 702_703insTCTC;705_705delAins795 |
| 5 | mouse | 16519 | Kcnj3 | potassium inwardly-rectifyi... | NM_008426.2 | 93% | 98.6% | (many diffs) |
| 6 | mouse | 16519 | Kcnj3 | potassium inwardly-rectifyi... | XM_006497730.3 | 93% | 98.6% | (many diffs) |
| 7 | mouse | 16519 | Kcnj3 | potassium inwardly-rectifyi... | XM_006497731.3 | 50.4% | 48.2% | (many diffs) |
| 8 | mouse | 16519 | Kcnj3 | potassium inwardly-rectifyi... | XM_011239030.2 | 49.5% | 52.2% | (many diffs) |
| 9 | mouse | 16519 | Kcnj3 | potassium inwardly-rectifyi... | XM_017315734.1 | 49.5% | 52.2% | (many diffs) |
| 10 | mouse | 16519 | Kcnj3 | potassium inwardly-rectifyi... | NM_001304810.1 | 43.8% | 46.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1569
- ORF length:
- 1503
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc tgcactccga aggaaatttg gggacgatta tcaggtagtg accacatcgt 121 ccagcggctc gggcttgcag ccccaggggc caggccagga ccctcagcag cagcttgtgc 181 ccaagaagaa gcggcagcgg ttcgtggaca agaacggccg gtgcaatgta cagcacggca 241 acctgggcag cgagacaagc cgctacctct cggacctctt caccacgctg gtggacctca 301 agtggcgctg gaacctcttc atcttcattc tcacctacac cgtggcctgg cttttcatgg 361 cgtccatgtg gtgggtgatc gcctacactc ggggcgacct gaacaaagcc cacgtcggta 421 actacacgcc ttgcgtggcc aatgtctata acttcccttc tgccttcctc ttcttcatcg 481 agacggaggc caccatcggc tatggctacc gatacatcac agacaagtgc cccgagggca 541 tcatcctctt cctcttccag tccatcctgg gctccatcgt ggacgccttc ctcatcggct 601 gcatgttcat caagatgtcc cagcccaaga agcgcgccga gaccctcatg ttcagcgagc 661 acgcggtgat ctccatgagg gacggaaaac tcacgcttat gttccgggtg ggcaacctgc 721 gcaacagcca catggtctcc gcgcagattc gctgcaagct gctcaaatct cggcagacac 781 ctgagggtga gttccttccc cttgaccaac ttgaactgga tgtaggtttt agtacagggg 841 cagatcaact ttttcttgtg tcccccctca caattcgcca cgtgatcgat gccaaaagcc 901 ccttttatga cctatcccag cgaagcatgc aaactaaaca gttcgagatt gtcgtcatcc 961 tagaaggcat tgtggaaaca actgggatga cttgtcaagc tcgaacatca tatactgaag 1021 atgaagttct ttggggtcat cgtttttttc ctgtaatttc cttagaagag ggattcttta 1081 aagttgatta ctcccagttc cacgcaacat ttgaagtccc caccccaCCT TACAGTGTGA 1141 AAGAGCAGGA GGAAATGCTT CTCATGTCGT CCCCTTTAAT AGCACCAGCC ATAACTAACA 1201 GCAAAGAAAG ACATAATTCT GTGGAATGCT TAGATGGACT AGATGATATT ACTACAAAAC 1261 TACCATCTAA GCTGCAGAAA ATTACTGGAA GAGAAGACTT TCCCAAAAAA CTCTTGAGGA 1321 TGAGTTCTAC AACTTCAGAA AAAGCCTACA GCTTGGGAGA CTTGCCCATG AAACTTCAAC 1381 GAATAAGTTC AGTTCCGGGC AACTCAGAAG AAAAACTGGT ATCTAAAACC ACCAAGATGT 1441 TATCTGATCC CATGAGCCAG TCTGTGGCTG ATTTGCCACC AAAGCTTCAA AAGATGGCTG 1501 GAGGAGCAGC TAGGATGGAA GGGAACCTTC CAGCCAAATT AAGAAAAATG AACTCTGATC 1561 GCTTCACATA CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1621 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1681 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGATTGTGA TAATGCCGAC TGATAATTAC 1741 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt