Transcript: Human NM_001261391.2

Homo sapiens calcium binding and coiled-coil domain 2 (CALCOCO2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
CALCOCO2 (10241)
Length:
3698
CDS:
55..1458

Additional Resources:

NCBI RefSeq record:
NM_001261391.2
NBCI Gene record:
CALCOCO2 (10241)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001261391.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130397 GAGCTGCTTCAACTGAAAGAA pLKO.1 739 CDS 100% 5.625 4.500 N CALCOCO2 n/a
2 TRCN0000280769 GAGCTGCTTCAACTGAAAGAA pLKO_005 739 CDS 100% 5.625 4.500 N CALCOCO2 n/a
3 TRCN0000129641 CCCTTTGTGAACTAAGTTCAA pLKO.1 2885 3UTR 100% 4.950 3.465 N CALCOCO2 n/a
4 TRCN0000280771 CCCTTTGTGAACTAAGTTCAA pLKO_005 2885 3UTR 100% 4.950 3.465 N CALCOCO2 n/a
5 TRCN0000128505 CCTGACTTGATACTAAGTGAT pLKO.1 1766 3UTR 100% 4.950 3.465 N CALCOCO2 n/a
6 TRCN0000280844 CCTGACTTGATACTAAGTGAT pLKO_005 1766 3UTR 100% 4.950 3.465 N CALCOCO2 n/a
7 TRCN0000129910 GAGTATTACCAGTTCTGCTAT pLKO.1 424 CDS 100% 4.950 3.465 N CALCOCO2 n/a
8 TRCN0000280772 GAGTATTACCAGTTCTGCTAT pLKO_005 424 CDS 100% 4.950 3.465 N CALCOCO2 n/a
9 TRCN0000130010 GCAGAATGAAACTACTGCAAT pLKO.1 987 CDS 100% 4.950 3.465 N CALCOCO2 n/a
10 TRCN0000131212 GACTTGCCTATGGAAACCCAT pLKO.1 1235 CDS 100% 2.640 1.848 N CALCOCO2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001261391.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02367 pDONR223 100% 95.5% 95.5% None 181_243del n/a
2 ccsbBroad304_02367 pLX_304 0% 95.5% 95.5% V5 181_243del n/a
3 TRCN0000478633 CAAGCCAACACCCTGTAAATATTA pLX_317 25.1% 95.5% 95.5% V5 181_243del n/a
4 ccsbBroadEn_07576 pDONR223 100% 95.4% 95.2% None 181_243del;880A>G n/a
5 ccsbBroad304_07576 pLX_304 0% 95.4% 95.2% V5 181_243del;880A>G n/a
6 TRCN0000473129 CTGTACACCCAGTATACTTTGCCA pLX_317 44.7% 95.4% 95.2% V5 181_243del;880A>G n/a
Download CSV