Transcript: Human NM_001261410.2

Homo sapiens BCAR3 adaptor protein, NSP family member (BCAR3), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
BCAR3 (8412)
Length:
2872
CDS:
168..2372

Additional Resources:

NCBI RefSeq record:
NM_001261410.2
NBCI Gene record:
BCAR3 (8412)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001261410.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000376434 ATGCCGCTTGTGACGTTAATG pLKO_005 2025 CDS 100% 13.200 18.480 N BCAR3 n/a
2 TRCN0000364816 TAACTGCCCTCTCGCGTAAAT pLKO_005 2317 CDS 100% 13.200 18.480 N BCAR3 n/a
3 TRCN0000369755 ATTAAGGTAACTACTGCTAAT pLKO_005 2584 3UTR 100% 10.800 15.120 N BCAR3 n/a
4 TRCN0000369682 GCGCCTGGACATAATTGAAAG pLKO_005 1676 CDS 100% 10.800 15.120 N BCAR3 n/a
5 TRCN0000072994 GCCCAACGAGTTTGAGTCAAA pLKO.1 1442 CDS 100% 4.950 6.930 N BCAR3 n/a
6 TRCN0000364815 TAGTATCCACAGGATATTAAA pLKO_005 2488 3UTR 100% 15.000 10.500 N BCAR3 n/a
7 TRCN0000376503 TCGGCATTGCAGTGGACATTC pLKO_005 1714 CDS 100% 10.800 7.560 N BCAR3 n/a
8 TRCN0000072997 CCTGGAAACAGCAATGTTGAA pLKO.1 1487 CDS 100% 4.950 3.465 N BCAR3 n/a
9 TRCN0000072995 CGAGATGGTGACTTCCTAGTT pLKO.1 402 CDS 100% 4.950 3.465 N BCAR3 n/a
10 TRCN0000072996 GACTGAATTTCAAATGCGATT pLKO.1 2231 CDS 100% 4.050 2.430 N BCAR3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001261410.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01924 pDONR223 100% 88.2% 85.3% None (many diffs) n/a
2 ccsbBroad304_01924 pLX_304 0% 88.2% 85.3% V5 (many diffs) n/a
3 TRCN0000468731 TGCGAACAGACTGACTAACACAGG pLX_317 16.5% 88.2% 85.3% V5 (many diffs) n/a
Download CSV