Transcript: Human NM_001261837.1

Homo sapiens phosphotriesterase related (PTER), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
PTER (9317)
Length:
3685
CDS:
288..1196

Additional Resources:

NCBI RefSeq record:
NM_001261837.1
NBCI Gene record:
PTER (9317)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001261837.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048799 CCCTAAGCAATGGCTAACTTT pLKO.1 1169 CDS 100% 5.625 7.875 N PTER n/a
2 TRCN0000290629 CCCTAAGCAATGGCTAACTTT pLKO_005 1169 CDS 100% 5.625 7.875 N PTER n/a
3 TRCN0000048801 CCGATGTCCTTATGAATGAAA pLKO.1 724 CDS 100% 5.625 7.875 N PTER n/a
4 TRCN0000290572 CCGATGTCCTTATGAATGAAA pLKO_005 724 CDS 100% 5.625 7.875 N PTER n/a
5 TRCN0000048802 CCATGACCTTTGACTGCTGTT pLKO.1 376 CDS 100% 4.050 3.240 N PTER n/a
6 TRCN0000290570 CCATGACCTTTGACTGCTGTT pLKO_005 376 CDS 100% 4.050 3.240 N PTER n/a
7 TRCN0000048798 CCTGTGAAATAAAGGGCATTT pLKO.1 3106 3UTR 100% 10.800 7.560 N PTER n/a
8 TRCN0000290630 CCTGTGAAATAAAGGGCATTT pLKO_005 3106 3UTR 100% 10.800 7.560 N PTER n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001261837.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02135 pDONR223 100% 86.5% 86.5% None 696_697ins141 n/a
2 ccsbBroad304_02135 pLX_304 0% 86.5% 86.5% V5 696_697ins141 n/a
3 TRCN0000475259 GCCCTCTTCTGATACGAGTCATCG pLX_317 34.3% 86.5% 86.5% V5 696_697ins141 n/a
4 ccsbBroadEn_15665 pDONR223 0% 86.4% 86.5% None 630T>C;696_697ins141 n/a
5 ccsbBroad304_15665 pLX_304 0% 86.4% 86.5% V5 630T>C;696_697ins141 n/a
6 TRCN0000474489 TTCCATCTACTATGCACCTCGTTC pLX_317 45.2% 86.4% 86.5% V5 630T>C;696_697ins141 n/a
Download CSV