Transcript: Human NM_001265587.2

Homo sapiens insulin like 3 (INSL3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
INSL3 (3640)
Length:
846
CDS:
14..487

Additional Resources:

NCBI RefSeq record:
NM_001265587.2
NBCI Gene record:
INSL3 (3640)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001265587.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438107 AGGCCACACAGCACCATAAAG pLKO_005 569 3UTR 100% 13.200 9.240 N INSL3 n/a
2 TRCN0000118961 CAGTGGCTGTACCCAACAAGA pLKO.1 459 CDS 100% 4.950 3.465 N INSL3 n/a
3 TRCN0000118958 CCCAGAGATGCGTGAGAAGTT pLKO.1 91 CDS 100% 4.950 3.465 N INSL3 n/a
4 TRCN0000442244 GGACACTGACAGCCAAATGTC pLKO_005 736 3UTR 100% 4.950 3.465 N INSL3 n/a
5 TRCN0000438118 AGAGACGACATCTGCTCCATG pLKO_005 320 CDS 100% 4.050 2.835 N INSL3 n/a
6 TRCN0000118960 GACAGTAATCTCACGCTGGGA pLKO.1 352 CDS 100% 0.660 0.462 N INSL3 n/a
7 TRCN0000118957 CCTTTGATTACCTCCTGGGAT pLKO.1 605 3UTR 100% 2.640 1.584 N INSL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001265587.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10923 pDONR223 100% 76.6% 39.7% None (many diffs) n/a
2 ccsbBroad304_10923 pLX_304 0% 76.6% 39.7% V5 (many diffs) n/a
3 TRCN0000475666 CTTAACGTGAATCTACTACTTAGC pLX_317 55.5% 76.6% 39.7% V5 (many diffs) n/a
4 ccsbBroadEn_06456 pDONR223 100% 76.4% 39.7% None (many diffs) n/a
5 ccsbBroad304_06456 pLX_304 0% 76.4% 39.7% V5 (many diffs) n/a
Download CSV