Transcript: Human NM_001265597.3

Homo sapiens zinc finger protein 211 (ZNF211), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ZNF211 (10520)
Length:
3929
CDS:
180..2069

Additional Resources:

NCBI RefSeq record:
NM_001265597.3
NBCI Gene record:
ZNF211 (10520)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001265597.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232217 GCTTCAGTTCACATCGGAAAG pLKO_005 1690 CDS 100% 6.000 4.800 N ZNF211 n/a
2 TRCN0000020971 GCCTGGTCTTGAGAGATATTT pLKO.1 721 CDS 100% 15.000 10.500 N ZNF211 n/a
3 TRCN0000232215 GCCTGGTCTTGAGAGATATTT pLKO_005 721 CDS 100% 15.000 10.500 N ZNF211 n/a
4 TRCN0000020969 CCACACAGTGTGTATCATTTA pLKO.1 2335 3UTR 100% 13.200 9.240 N ZNF211 n/a
5 TRCN0000020970 GCTGTAAATCTAACCTCATTA pLKO.1 1846 CDS 100% 13.200 9.240 N ZNF211 n/a
6 TRCN0000232216 ATTCTACATCAGTGCAAATCT pLKO_005 803 CDS 100% 5.625 3.938 N ZNF211 n/a
7 TRCN0000020972 GCACATTACAGAGGCACCTTT pLKO.1 842 CDS 100% 4.950 3.465 N ZNF211 n/a
8 TRCN0000232218 GCCATAGCTCCAACCTTAAGA pLKO_005 1762 CDS 100% 5.625 3.375 N ZNF211 n/a
9 TRCN0000020973 GCAGCGAATGTGGGAAATCTT pLKO.1 1486 CDS 100% 5.625 2.813 Y ZNF211 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001265597.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11512 pDONR223 100% 88.3% 85% None (many diffs) n/a
2 ccsbBroad304_11512 pLX_304 0% 88.3% 85% V5 (many diffs) n/a
3 TRCN0000476279 AATTGATATTGTTCCTCAGAAATG pLX_317 18.4% 88.3% 85% V5 (many diffs) n/a
Download CSV