Transcript: Human NM_001265602.1

Homo sapiens structural maintenance of chromosomes 2 (SMC2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
SMC2 (10592)
Length:
6008
CDS:
305..3898

Additional Resources:

NCBI RefSeq record:
NM_001265602.1
NBCI Gene record:
SMC2 (10592)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001265602.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062541 CCCTAAATATTGCATGGCAAA pLKO.1 3390 CDS 100% 4.050 5.670 N SMC2 n/a
2 TRCN0000291368 CCCTAAATATTGCATGGCAAA pLKO_005 3390 CDS 100% 4.050 5.670 N SMC2 n/a
3 TRCN0000062540 GCCCTTCAAGAAGCAAGTAAT pLKO.1 1385 CDS 100% 13.200 9.240 N SMC2 n/a
4 TRCN0000291365 GCCCTTCAAGAAGCAAGTAAT pLKO_005 1385 CDS 100% 13.200 9.240 N SMC2 n/a
5 TRCN0000062538 CCAGATTTACTCAATGTCAAA pLKO.1 3810 CDS 100% 4.950 3.465 N SMC2 n/a
6 TRCN0000291367 CCAGATTTACTCAATGTCAAA pLKO_005 3810 CDS 100% 4.950 3.465 N SMC2 n/a
7 TRCN0000062542 GCTATGAATGTATTGACAGAA pLKO.1 3263 CDS 100% 4.950 3.465 N SMC2 n/a
8 TRCN0000291366 GCTATGAATGTATTGACAGAA pLKO_005 3263 CDS 100% 4.950 3.465 N SMC2 n/a
9 TRCN0000062539 GCCAGATGTATTGCACCAGAA pLKO.1 2051 CDS 100% 4.050 2.835 N SMC2 n/a
10 TRCN0000291369 GCCAGATGTATTGCACCAGAA pLKO_005 2051 CDS 100% 4.050 2.835 N SMC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001265602.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.