Transcript: Human NM_001267043.2

Homo sapiens AE binding protein 2 (AEBP2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-18
Taxon:
Homo sapiens (human)
Gene:
AEBP2 (121536)
Length:
4519
CDS:
107..1012

Additional Resources:

NCBI RefSeq record:
NM_001267043.2
NBCI Gene record:
AEBP2 (121536)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001267043.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107984 CAATTTCCAGTGGGCGTTCAA pLKO.1 162 CDS 100% 4.950 6.930 N AEBP2 n/a
2 TRCN0000107982 GCGATAAGACATCGAGCCATA pLKO.1 671 CDS 100% 4.050 5.670 N AEBP2 n/a
3 TRCN0000095566 GCTACCCAAAGATACTGCCTT pLKO.1 895 CDS 100% 2.640 2.112 N Aebp2 n/a
4 TRCN0000107983 CCCAAACATATACAGAACAAT pLKO.1 925 CDS 100% 5.625 3.938 N AEBP2 n/a
5 TRCN0000107980 GCACCAAAGTTGGTCTTGAAA pLKO.1 1338 3UTR 100% 5.625 3.938 N AEBP2 n/a
6 TRCN0000107981 GCAGATCACATCCGTTCCATA pLKO.1 293 CDS 100% 4.950 3.465 N AEBP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001267043.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13084 pDONR223 100% 91.5% 90.3% None (many diffs) n/a
2 ccsbBroad304_13084 pLX_304 0% 91.5% 90.3% V5 (many diffs) n/a
3 TRCN0000470180 CCGAGCCAACGTTAGCATCGTCAA pLX_317 44.4% 91.5% 90.3% V5 (many diffs) n/a
Download CSV