Transcript: Human NM_001267565.1

Homo sapiens cAMP responsive element modulator (CREM), transcript variant 26, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
CREM (1390)
Length:
1118
CDS:
188..583

Additional Resources:

NCBI RefSeq record:
NM_001267565.1
NBCI Gene record:
CREM (1390)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001267565.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273840 GCAGTACCAACTAGCATATAT pLKO_005 488 CDS 100% 15.000 21.000 N CREM n/a
2 TRCN0000273901 GTATTGACAGCTGTCATATAA pLKO_005 695 3UTR 100% 15.000 10.500 N CREM n/a
3 TRCN0000273900 GAAGGAACACCACCTAGTATT pLKO_005 458 CDS 100% 13.200 9.240 N CREM n/a
4 TRCN0000013723 GCGAACATAAATGTCTGTATT pLKO.1 845 3UTR 100% 13.200 9.240 N CREM n/a
5 TRCN0000273838 TGCTGCAATTCGATATGATAC pLKO_005 538 CDS 100% 10.800 7.560 N CREM n/a
6 TRCN0000013727 GCTAGCTTTAAGTCTTCTCTA pLKO.1 562 CDS 100% 4.950 3.465 N CREM n/a
7 TRCN0000013725 CCAAGATTGAAGAAGAGAGAT pLKO.1 429 CDS 100% 4.950 2.970 N CREM n/a
8 TRCN0000157610 GTGGCATGATCTCAGCTCATT pLKO.1 301 CDS 100% 4.950 2.475 Y CCNJL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001267565.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06036 pDONR223 100% 70% 50.3% None (many diffs) n/a
2 ccsbBroad304_06036 pLX_304 0% 70% 50.3% V5 (many diffs) n/a
Download CSV