Transcript: Human NM_001267700.1

Homo sapiens prohibitin 2 (PHB2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
PHB2 (11331)
Length:
1343
CDS:
211..996

Additional Resources:

NCBI RefSeq record:
NM_001267700.1
NBCI Gene record:
PHB2 (11331)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001267700.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060918 CCAGAATATCTCCAAGACGAT pLKO.1 867 CDS 100% 2.640 3.696 N PHB2 n/a
2 TRCN0000299608 CCAGAATATCTCCAAGACGAT pLKO_005 867 CDS 100% 2.640 3.696 N PHB2 n/a
3 TRCN0000060920 GCGAGTGTTGTCTCGACCCAA pLKO.1 528 CDS 100% 0.880 1.232 N PHB2 n/a
4 TRCN0000299606 GCGAGTGTTGTCTCGACCCAA pLKO_005 528 CDS 100% 0.880 1.232 N PHB2 n/a
5 TRCN0000060919 GCCTCATCAAGGGTAAGAAAT pLKO.1 974 CDS 100% 13.200 9.240 N PHB2 n/a
6 TRCN0000299607 GCCTCATCAAGGGTAAGAAAT pLKO_005 974 CDS 100% 13.200 9.240 N PHB2 n/a
7 TRCN0000060921 GCTGAGCTTTAGCCGAGAGTA pLKO.1 768 CDS 100% 4.950 3.465 N PHB2 n/a
8 TRCN0000299605 GCTGAGCTTTAGCCGAGAGTA pLKO_005 768 CDS 100% 4.950 3.465 N PHB2 n/a
9 TRCN0000060922 CCTAGCATGTACCAGCGCCTA pLKO.1 562 CDS 100% 0.720 0.504 N PHB2 n/a
10 TRCN0000299609 CCTAGCATGTACCAGCGCCTA pLKO_005 562 CDS 100% 0.720 0.504 N PHB2 n/a
11 TRCN0000054431 GCTGACAACCTTGTGCTGAAT pLKO.1 919 CDS 100% 4.950 3.465 N Phb2 n/a
12 TRCN0000302294 GCTGACAACCTTGTGCTGAAT pLKO_005 919 CDS 100% 4.950 3.465 N Phb2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001267700.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02676 pDONR223 100% 87.2% 87.2% None 606_607ins114 n/a
2 ccsbBroad304_02676 pLX_304 0% 87.2% 87.2% V5 606_607ins114 n/a
3 TRCN0000469876 TTCTACGGCAAACCCGTACGCGAC pLX_317 41.3% 87.2% 87.2% V5 606_607ins114 n/a
Download CSV