Transcript: Mouse NM_001267715.1

Mus musculus peroxisomal biogenesis factor 2 (Pex2), transcript variant 9, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Pex2 (19302)
Length:
2006
CDS:
447..1364

Additional Resources:

NCBI RefSeq record:
NM_001267715.1
NBCI Gene record:
Pex2 (19302)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001267715.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040503 CCTTGGCATTCATTCCGTATT pLKO.1 956 CDS 100% 10.800 15.120 N Pex2 n/a
2 TRCN0000287486 CCTTGGCATTCATTCCGTATT pLKO_005 956 CDS 100% 10.800 15.120 N Pex2 n/a
3 TRCN0000040504 CCTCACACTATTGGATGTGAA pLKO.1 1206 CDS 100% 0.495 0.693 N Pex2 n/a
4 TRCN0000287571 CCTCACACTATTGGATGTGAA pLKO_005 1206 CDS 100% 0.495 0.693 N Pex2 n/a
5 TRCN0000295040 GTATCCAGTTCCTTGGAATTA pLKO_005 1398 3UTR 100% 13.200 10.560 N Pex2 n/a
6 TRCN0000040507 CCAGAAGTTGAAAGCCAAATT pLKO.1 1085 CDS 100% 13.200 9.240 N Pex2 n/a
7 TRCN0000287569 CCAGAAGTTGAAAGCCAAATT pLKO_005 1085 CDS 100% 13.200 9.240 N Pex2 n/a
8 TRCN0000294977 TGGTTAGAAGAACGATGTTAT pLKO_005 789 CDS 100% 13.200 9.240 N Pex2 n/a
9 TRCN0000040505 CAGCCCTTGAAATCAGGAATT pLKO.1 1317 CDS 100% 0.000 0.000 N Pex2 n/a
10 TRCN0000040506 CCTATGGAGGTTCACCATCTA pLKO.1 635 CDS 100% 4.950 2.970 N Pex2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001267715.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01352 pDONR223 100% 86.6% 88.1% None (many diffs) n/a
2 TRCN0000474120 CAATGAGTATTAATGCGAAAAACC pLX_317 44.7% 86.6% 88.1% V5 (many diffs) n/a
Download CSV