Transcript: Human NM_001267809.1

Homo sapiens interleukin enhancer binding factor 2 (ILF2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
ILF2 (3608)
Length:
1953
CDS:
240..1298

Additional Resources:

NCBI RefSeq record:
NM_001267809.1
NBCI Gene record:
ILF2 (3608)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001267809.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014553 CCCATTTGTGACCTATGCCAT pLKO.1 1474 3UTR 100% 2.640 3.696 N ILF2 n/a
2 TRCN0000329726 CCCATTTGTGACCTATGCCAT pLKO_005 1474 3UTR 100% 2.640 3.696 N ILF2 n/a
3 TRCN0000353627 TCGACAGGTGGGATCCTATAA pLKO_005 431 CDS 100% 13.200 9.240 N ILF2 n/a
4 TRCN0000014556 CCAACGAAACTGGCTTTGAAA pLKO.1 601 CDS 100% 5.625 3.938 N ILF2 n/a
5 TRCN0000329725 CCAACGAAACTGGCTTTGAAA pLKO_005 601 CDS 100% 5.625 3.938 N ILF2 n/a
6 TRCN0000014555 CCTGGGATGGAGTGATAGTAA pLKO.1 1159 CDS 100% 5.625 3.938 N ILF2 n/a
7 TRCN0000329784 CCTGGGATGGAGTGATAGTAA pLKO_005 1159 CDS 100% 5.625 3.938 N ILF2 n/a
8 TRCN0000014554 CCAGGGACATTTGAAGTGCAA pLKO.1 399 CDS 100% 2.640 1.848 N ILF2 n/a
9 TRCN0000014557 CCTTTGTACCACATATCCCAT pLKO.1 180 5UTR 100% 2.640 1.848 N ILF2 n/a
10 TRCN0000066745 GCTATCTTGCTTCTGAAATAT pLKO.1 1135 CDS 100% 15.000 9.000 N Ilf2 n/a
11 TRCN0000302157 GCTATCTTGCTTCTGAAATAT pLKO_005 1135 CDS 100% 15.000 9.000 N Ilf2 n/a
12 TRCN0000066747 CCACAGTTAAAGTTCTCATAA pLKO.1 778 CDS 100% 13.200 9.240 N Ilf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001267809.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00865 pDONR223 100% 90.2% 90.2% None 0_1ins114 n/a
2 ccsbBroad304_00865 pLX_304 0% 90.2% 90.2% V5 0_1ins114 n/a
3 TRCN0000469482 GGTGATCGACTTGTCTACCCGGCA pLX_317 30.2% 90.2% 90.2% V5 0_1ins114 n/a
Download CSV