Transcript: Human NM_001267812.1

Homo sapiens solute carrier family 12 member 9 (SLC12A9), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
SLC12A9 (56996)
Length:
2288
CDS:
161..2056

Additional Resources:

NCBI RefSeq record:
NM_001267812.1
NBCI Gene record:
SLC12A9 (56996)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001267812.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042987 CCCACTGGTGTTGATCGGAAT pLKO.1 1189 CDS 100% 4.050 5.670 N SLC12A9 n/a
2 TRCN0000042985 CTGTCCTCTTTAACGGCTGTA pLKO.1 975 CDS 100% 4.050 5.670 N SLC12A9 n/a
3 TRCN0000042984 GCTCATGTTCTACCTGGCTAA pLKO.1 523 CDS 100% 4.050 2.835 N SLC12A9 n/a
4 TRCN0000042986 CAGGTGCGTAAGTATCTGCTT pLKO.1 1694 CDS 100% 2.640 1.848 N SLC12A9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001267812.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12322 pDONR223 100% 84.5% 84.4% None (many diffs) n/a
2 ccsbBroad304_12322 pLX_304 0% 84.5% 84.4% V5 (many diffs) n/a
3 TRCN0000479741 TTCGTTTTGATTCCTGAGGCTAAC pLX_317 22.2% 84.5% 84.4% V5 (many diffs) n/a
Download CSV