Transcript: Mouse NM_001267847.1

Mus musculus fidgetin (Fign), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Fign (60344)
Length:
9798
CDS:
415..2661

Additional Resources:

NCBI RefSeq record:
NM_001267847.1
NBCI Gene record:
Fign (60344)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001267847.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098224 CTTAGCATTTAAGCCAACAAA pLKO.1 1500 CDS 100% 5.625 7.875 N Fign n/a
2 TRCN0000098220 GCTGACAGAAAGCATATACAT pLKO.1 2865 3UTR 100% 5.625 7.875 N Fign n/a
3 TRCN0000098221 CCCGTTACATATCAAGACTTT pLKO.1 2548 CDS 100% 4.950 6.930 N Fign n/a
4 TRCN0000244991 AGTCGGATGAGAACCGAATTT pLKO_005 2188 CDS 100% 13.200 9.240 N FIGN n/a
5 TRCN0000098223 CCTGGGCGAATGATGACATAT pLKO.1 539 CDS 100% 13.200 9.240 N Fign n/a
6 TRCN0000010028 TGGACGAGCAACTGAAGAATA pLKO.1 1751 CDS 100% 13.200 9.240 N FIGN n/a
7 TRCN0000010043 GCCCGACAACAGCATTTCAAA pLKO.1 1434 CDS 100% 5.625 3.938 N FIGN n/a
8 TRCN0000098222 GCGGTTATTAAGGAGGAGGTT pLKO.1 1867 CDS 100% 2.640 1.848 N Fign n/a
9 TRCN0000010042 CTGAGGACCAAATCGTAGTAA pLKO.1 2240 CDS 100% 5.625 3.938 N FIGN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001267847.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487786 CATGCCTTCATGGACACGATCTTC pLX_317 3.2% 78.9% 83.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV