Transcript: Human NM_001270402.2

Homo sapiens potassium voltage-gated channel subfamily E regulatory subunit 1 (KCNE1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-07-21
Taxon:
Homo sapiens (human)
Gene:
KCNE1 (3753)
Length:
3350
CDS:
401..790

Additional Resources:

NCBI RefSeq record:
NM_001270402.2
NBCI Gene record:
KCNE1 (3753)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001270402.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256491 GTCCGATGCCTGGCAAGAGAA pLKO_005 649 CDS 100% 1.650 0.990 N KCNE1 n/a
2 TRCN0000265811 GGCACACGGACTGGCTATTTA pLKO_005 2933 3UTR 100% 15.000 7.500 Y KCNE1 n/a
3 TRCN0000256494 TACTGATACACCTACCTTATA pLKO_005 1401 3UTR 100% 13.200 6.600 Y KCNE1 n/a
4 TRCN0000045054 CCTCATGGTACTGGGATTCTT pLKO.1 541 CDS 100% 5.625 2.813 Y KCNE1 n/a
5 TRCN0000045056 GCACTCGAACGACCCATTCAA pLKO.1 616 CDS 100% 5.625 2.813 Y KCNE1 n/a
6 TRCN0000256490 GGTCGTGCTATGTCGTTGAAA pLKO_005 711 CDS 100% 5.625 2.813 Y KCNE1 n/a
7 TRCN0000256492 ACCATCTGGCCATAGAACAAC pLKO_005 732 CDS 100% 4.950 2.475 Y KCNE1 n/a
8 TRCN0000256495 AGAGAAGGACAAGGCCTATGT pLKO_005 664 CDS 100% 4.950 2.475 Y KCNE1 n/a
9 TRCN0000045053 CGACCCATTCAACGTCTACAT pLKO.1 625 CDS 100% 4.950 2.475 Y KCNE1 n/a
10 TRCN0000281490 TTCTTCACCCTGGGCATCATG pLKO_005 566 CDS 100% 4.950 2.475 Y KCNE1 n/a
11 TRCN0000256493 ACCTTCCTGAGACGAAGCCTT pLKO_005 762 CDS 100% 2.640 1.320 Y KCNE1 n/a
12 TRCN0000256496 CAACCCAACACACACCTTCCT pLKO_005 749 CDS 100% 2.640 1.320 Y KCNE1 n/a
13 TRCN0000045055 GCTGAGCTACATCCGCTCCAA pLKO.1 586 CDS 100% 0.880 0.440 Y KCNE1 n/a
14 TRCN0000045057 CAGGAGACAGTTCAGCAGGGT pLKO.1 452 CDS 100% 0.220 0.110 Y KCNE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001270402.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10932 pDONR223 100% 80.8% 79.8% None 95G>A;112A>G;316_387del n/a
2 ccsbBroad304_10932 pLX_304 0% 80.8% 79.8% V5 95G>A;112A>G;316_387del n/a
3 TRCN0000470318 AGATCCCTGCCGCGAGGGTCTTTC pLX_317 100% 80.8% 79.8% V5 95G>A;112A>G;316_387del n/a
Download CSV