Transcript: Human NM_001270424.1

Homo sapiens dehydrogenase/reductase 12 (DHRS12), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
DHRS12 (79758)
Length:
1239
CDS:
54..1007

Additional Resources:

NCBI RefSeq record:
NM_001270424.1
NBCI Gene record:
DHRS12 (79758)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001270424.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243368 TGCAGGTTGCATGGTCAATAA pLKO_005 428 CDS 100% 13.200 18.480 N DHRS12 n/a
2 TRCN0000243365 CAAAGCAACTGCCCTTGAAAT pLKO_005 212 CDS 100% 13.200 10.560 N DHRS12 n/a
3 TRCN0000243367 CCGAAGAGGAGAAACTCATTG pLKO_005 952 CDS 100% 10.800 7.560 N DHRS12 n/a
4 TRCN0000243366 CTTGTCTGATCCCAAGCAAAT pLKO_005 350 CDS 100% 10.800 7.560 N DHRS12 n/a
5 TRCN0000243364 TTGATGGAACTATGGTCTATG pLKO_005 637 CDS 100% 10.800 7.560 N DHRS12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001270424.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04119 pDONR223 100% 65.6% 50.4% None (many diffs) n/a
2 ccsbBroad304_04119 pLX_304 0% 65.6% 50.4% V5 (many diffs) n/a
3 TRCN0000468391 AACACCACTTAACGTATCCTGGCA pLX_317 35.6% 65.6% 50.4% V5 (many diffs) n/a
Download CSV