Transcript: Human NM_001270873.2

Homo sapiens gamma-aminobutyric acid type A receptor gamma3 subunit (GABRG3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
GABRG3 (2567)
Length:
1617
CDS:
356..1117

Additional Resources:

NCBI RefSeq record:
NM_001270873.2
NBCI Gene record:
GABRG3 (2567)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001270873.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063055 CCTTCGATTCAACAGCACAAT pLKO.1 673 CDS 100% 4.950 3.960 N GABRG3 n/a
2 TRCN0000063054 CGTGACTCTTATTCTCAACAA pLKO.1 493 CDS 100% 4.950 3.960 N GABRG3 n/a
3 TRCN0000428409 GTAATTGACGTTGACATTTAT pLKO_005 569 CDS 100% 15.000 10.500 N GABRG3 n/a
4 TRCN0000063053 CCAGAAATCATGGCGGCTTTA pLKO.1 991 CDS 100% 10.800 7.560 N GABRG3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001270873.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.