Transcript: Human NM_001271033.1

Homo sapiens neural precursor cell expressed, developmentally down-regulated 9 (NEDD9), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
NEDD9 (4739)
Length:
4103
CDS:
168..2225

Additional Resources:

NCBI RefSeq record:
NM_001271033.1
NBCI Gene record:
NEDD9 (4739)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001271033.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004968 GCAGCTCAAGACCATAGTCAT pLKO.1 2075 CDS 100% 4.950 6.930 N NEDD9 n/a
2 TRCN0000004967 GCCCAGTTCTTATTTAGCATT pLKO.1 3573 3UTR 100% 4.950 6.930 N NEDD9 n/a
3 TRCN0000004969 CCTGAATATCTTGGCCATCAA pLKO.1 1256 CDS 100% 4.950 3.465 N NEDD9 n/a
4 TRCN0000004970 CGTGGAGAATGACATCTCGAA pLKO.1 1757 CDS 100% 2.640 1.848 N NEDD9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271033.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488594 TCAACGTTTGTTTCGGCCGTGTCA pLX_317 13.9% 82% 81.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV